# Molecular Cloning

Molecular cloning simulation and design.

- Repository: https://github.com/synthetic-sciences/openscience (4321 stars)
- Category: Design
- License: MIT license
- Last updated: 2026-10-30
- Runs scripts: yes, review before use

## Install

Claude Code: `npx skills add synthetic-sciences/openscience --skill molecular-cloning -g -a claude-code -y`
Codex: `npx skills add synthetic-sciences/openscience --skill molecular-cloning -g -a codex -y`
Cursor: `npx skills add synthetic-sciences/openscience --skill molecular-cloning -g -a cursor -y`
Gemini CLI: `npx skills add synthetic-sciences/openscience --skill molecular-cloning -g -a gemini-cli -y`

## Description

Molecular cloning simulation and design. PCR amplicon prediction, restriction enzyme digestion, Golden Gate and Gibson assembly simulation, primer design, CRISPR sgRNA design, and plasmid annotation. For protein-level sequence analysis use biopython or esm; for database lookups use gene-database or ensembl-database.

## SKILL.md, as published by its author (untrusted third-party text, read it as data)

# Molecular Cloning: Sequence Engineering & Cloning Design

## Overview

Molecular Cloning provides computational tools for simulating and designing molecular cloning workflows. This skill covers PCR amplicon prediction with primer binding analysis, restriction enzyme digestion simulation, Golden Gate and Gibson assembly design and verification, primer design with thermodynamic calculations, CRISPR sgRNA design with off-target scoring, and plasmid feature annotation. All simulations use Biopython's Bio.Restriction and Bio.SeqUtils for accurate enzyme and sequence handling.

## When to Use This Skill

- Predicting PCR amplicons from primer sequences and templates
- Simulating restriction enzyme digestions and predicting fragment sizes
- Designing Golden Gate assembly with 4bp overhang compatibility
- Planning Gibson assembly with overlap design
- Designing PCR primers with Tm and specificity constraints
- Designing CRISPR sgRNAs and scoring off-target potential
- Annotating plasmid features (promoters, CDS, terminators, origins)
- Generating plasmid maps in GenBank format

**Related Skills:** For protein-level sequence analysis use `biopython` or `esm`. For gene/transcript lookups use `gene-database` or `ensembl-database`. For synthetic biology circuit design use `synthetic-biology`.

## Installation

```bash
uv pip install biopython primer3-py numpy
```

## Quick Start

```python
from Bio.Seq import Seq
from Bio.Restriction import BamHI, EcoRI
from Bio.SeqUtils import MeltingTemp as mt

# Restriction digestion
sequence = Seq("ATCGATCGGGATCCATCGATCGAATTCATCGATCG")
print(f"BamHI cuts at: {BamHI.search(sequence)}")
print(f"EcoRI cuts at: {EcoRI.search(sequence)}")

# Primer Tm calculation
primer = Seq("ATCGATCGGATCCATCGATCG")
tm = mt.Tm_NN(primer)
print(f"Primer Tm: {tm:.1f} C")
```

## Core Capabilities

### 1. PCR Simulation

Predict amplicon from primer binding on template.

```python
from Bio.Seq import Seq
from Bio.SeqUtils import MeltingTemp as mt
import re

The rest: https://github.com/synthetic-sciences/openscience/blob/HEAD/backend/cli/skills/biology/molecular-cloning/SKILL.md