Bioconductor Cellbarcode
The package CellBarcode performs Cellular DNA Barcode analysis.
Install
npx skills add bioMate-AI/biomate-bioconductor-kb --skill bioconductor-cellbarcode -g -a claude-code -y- Repository
- bioMate-AI/biomate-bioconductor-kb793
- Category
- Engineering
- Updated
- 5mo ago
- License
- See repository
- Context cost
- Lightabout 1,208 tokens
- Runs scripts
- No, instructions only
What it does
The package CellBarcode performs Cellular DNA Barcode analysis. It can handle all kinds of DNA barcodes, as long as the barcode is within a single sequencing read and has a pattern that can be matched by a regular expression. \code{CellBarcode} can handle barcodes with flexible lengths, with or without UMI (unique molecular identifier). This tool also can be used for pre-processing some amplicon data such as CRISPR gRNA screening, immune repertoire sequencing, and metagenome data.
CellBarcode
Workflows
Standard Workflow
Perform quality control, filter, extract, cure, and quantify lineage barcodes and UMIs from raw FASTQ files.
library(CellBarcode)
# 1. Load User Inputs
example_data <- system.file("extdata", "mef_test_data", package = "CellBarcode")
fq_files <- dir(example_data, "fastq.gz", full=TRUE)
sample_name <- paste0("sample_", seq_along(fq_files))
# 2. Quality Control
qc_noFilter <- bc_seq_qc(fq_files)
bc_plot_seqQc(qc_noFilter)
# 3. Filtering
fq_filter <- bc_seq_filter(fq_files, min_average_quality = 30, min_read_length = 60, sample_name = sample_name)
# 4. Extraction
pattern <- "([ACGT]{12})CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT"
bc_obj <- bc_extract(fq_filter, pattern = pattern, pattern_type = c("UMI" = 1, "barcode" = 2), sample_name = sample_name)
# 5. Curing and Quantification
bc_sub <- bc_cure_umi(bc_obj, depth = 2)
bc_sub <- bc_cure_depth(bc_sub, depth = 2)
# 6. Export
df_counts <- bc_2df(bc_sub)
mat_counts <- bc_2matrix(bc_sub)
Inputs/Outputs: Takes raw FASTQ files and a regular expression pattern as inputs, and outputs a BarcodeObj containing cleaned barcode and UMI counts, exportable to a data frame (bc_2df) or matrix (bc_2matrix).
Scrnaseq Sam Lineage Barcoding
Extract lineage barcodes, cell barcodes, and UMIs from 10X Genomics single-cell RNA-seq SAM files.
library(CellBarcode)
# 1. Load User Inputs
sam_file <- system.file("extdata", "scRNASeq_10X.sam", package = "CellBarcode")
# 2. Extract Lineage Barcode
d <- bc_extract_sc_sam(
sam = sam_file,
pattern = "AGATCAG(.*)TGTGGTA",
cell_barcode_tag = "CR",
umi_tag = "UR"
)
Inputs/Outputs: Takes a SAM file derived from 10X Genomics CellRanger output and a regular expression pattern as inputs, and outputs a data frame containing cell_barcode, umi, barcode_seq, and count.
